|
Proteome Software Inc
paper n a plasmid Paper N A Plasmid, supplied by Proteome Software Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+n+paper+plasmid/pm38985674-463-69-167 Average 86 stars, based on 1 article reviews
paper n a plasmid - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
n a quantitect rt pcr primer assay hs gapdh qiagen qt01192646 software N A Quantitect Rt Pcr Primer Assay Hs Gapdh Qiagen Qt01192646 Software, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/N%2FA+QuantiTect+RT-PCR+Primer+assay+HS_GAPDH+Qiagen+QT01192646+Software/10__1016_slash_j__isci__2025__113394-230-47-81 Average 94 stars, based on 1 article reviews
n a quantitect rt pcr primer assay hs gapdh qiagen qt01192646 software - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Partek
krashes lab n a oligonucleotides recombinant dna software Krashes Lab N A Oligonucleotides Recombinant Dna Software, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+dna+krashes+lab+n+oligonucleotides+recombinant+software/pm42025694-848-58-76 Average 86 stars, based on 1 article reviews
krashes lab n a oligonucleotides recombinant dna software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Plumtree Software Inc
w*–n curve of a= 15 W*–N Curve Of A= 15, supplied by Plumtree Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/w++n+curve+of+a++15/10__1016_slash_j__cja__2017__03__019-98-6-0 Average 90 stars, based on 1 article reviews
w*–n curve of a= 15 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OpenEye Scientific Software Inc
n.a./500/85,061 N.A./500/85,061, supplied by OpenEye Scientific Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/n+a++500+85+061/pmc09781938-14-10-6 Average 90 stars, based on 1 article reviews
n.a./500/85,061 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
10X Genomics
paper n a software Paper N A Software, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+n+paper+software/pm37995179-239-150-169 Average 86 stars, based on 1 article reviews
paper n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Partek
paper n a software Paper N A Software, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+n+paper+software/pm35081341-275-77-101 Average 86 stars, based on 1 article reviews
paper n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
10X Genomics
rhabdomys pumilio liver n a software ![]() Rhabdomys Pumilio Liver N A Software, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+liver+n+pumilio+rhabdomys+software/pm34433012-485-145-175 Average 86 stars, based on 1 article reviews
rhabdomys pumilio liver n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
tcaggaggagcaatgatcttg sangon biotech n a recombinant dna plko ![]() Tcaggaggagcaatgatcttg Sangon Biotech N A Recombinant Dna Plko, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/1+1+a+a+biotech+biotech+dna+n+n+n000013+nc+plko+plko+recombinant+sangon+sangon+shcherp+software/pm40449480-254-209-210 Average 86 stars, based on 1 article reviews
tcaggaggagcaatgatcttg sangon biotech n a recombinant dna plko - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
10X Genomics
manuscript n a software ![]() Manuscript N A Software, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+manuscript+n+software/pm38579725-501-256-282 Average 86 stars, based on 1 article reviews
manuscript n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Kent Scientific Corp
qpcr primers sequences n a software ![]() Qpcr Primers Sequences N A Software, supplied by Kent Scientific Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+n+primers+qpcr+sequences+software/pmc07671941__mmc3-304-25-45 Average 86 stars, based on 1 article reviews
qpcr primers sequences n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
tgtagaccatgtagttgaggtca sangon biotech n a software ![]() Tgtagaccatgtagttgaggtca Sangon Biotech N A Software, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+biotech+n+sangon+software+tgtagaccatgtagttgaggtca/pm38159573-806-263-264 Average 86 stars, based on 1 article reviews
tgtagaccatgtagttgaggtca sangon biotech n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Parallel pathways for recruiting effector proteins determine centromere drive and suppression.
doi: 10.1016/j.cell.2021.07.037
Figure Lengend Snippet: Figure 2. Introducing rat CENP-C in mouse oocytes weakens the kinetochore pathway and makes centromeres functionally more symmetric (A) CENP-C divergence between Mus musculus (mouse), Rattus norvegicus (rat), and Rhabdomys pumilio (a model organism closely related to Rhabdomys dilectus, Figure 4B). (B and C) CF-1 oocytes were microinjected with cRNA for GFP-tagged mouse or rat CENP-C and fixed in prometaphase/metaphase I. Cells were stained for SGO2 (A) or analyzed for GFP fluorescence (B). 10 mm scale bars, 2.2 mm square insets. Plots show centromere signal intensities. Each dot represents a single centromere (n = 200 centromeres from 20 oocytes for each construct); red line, mean; *p < 0.05; ns, not significant. (D and E) CF-1 oocytes were microinjected with cRNA for GFP-tagged mouse or R. pumilio CENP-C and fixed in prometaphase/metaphase I. Cells were analyzed for GFP fluorescence (D) or stained for SGO2 (E). 10 mm scale bars, 2.2 mm square insets. Plots show centromere signal intensities. Each dot represents a single centromere (n R 170 centromeres from R22 oocytes for each construct); red line, mean. (F) Different CENP-C interfaces have changed to modulate effector recruitment. Schematics summarize the results of (B)–(E). Compared to mouse CENP-C, rat CENP-C is similarly recruited to mouse centromere chromatin, but downstream effector recruitment is reduced. In contrast, R. pumilio CENP-C is recruited at higher levels to mouse centromere chromatin, leading to increased effector recruitment.
Article Snippet: Reagent or resource Source Identifier GeneArt Precision gRNA Synthesis Kit Thermo Fisher Scientific A29377 MEGAclear Transcription Clean-Up Kit Thermo Fisher Scientific AM1908 Deposited data Genome assemblies NCBI BioProject database Accession Number PRJNA669840 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory 664 Mouse: ZALENDE/EiJ (CHPO) The Jackson Laboratory 1392 Mouse: NSA (CF-1) Envigo 33 Oligonucleotides Forward primer for Cenpb genotyping: 50- CAGCTGACGTTCCGGGAGAA-30 This paper N/A Reverse primer for Cenpb genotyping: 50- GGGGACAGCTTGTTGGTCTT-30 This paper N/A gRNA target sequence for Cenpb null mice: 50-GAAGAACAAGCGCGCCA-30 This paper N/A gRNA target sequence for minor satellite repeats: 50- ACACTGAAAAACACATTCGT-30 This paper N/A Recombinant DNA H2B-EGFP Akera et al., 2017 N/A H2B-mCherry Akera et al., 2017 N/A dCas9-EGFP This paper N/A dCas9-mCherry This paper N/A EGFP-MmCENP-C This paper, cDNA from the Mus musculus liver N/A EGFP-RnCENP-C This paper, cDNA from the Rattus norvegicus liver N/A EGFP-RpCENP-C This paper, cDNA from the
Techniques: Staining, Construct